Full Length Research Paper - African Journal of Food Science and Technology ( 127) Volume 12, Issue 1
, DOI: 10.37421/ajfst.2021.12.006
Acetic acid bacteria (AAB) is a group of Gram-negative bacteria, non-spore forming, catalase-positive, and strictly aerobic (Andres-Barrao et al., 2012). The group of AAB are heterogeneous organisms motile or non-with peritrichous flagella rods that carry out incomplete oxidation of alcohol and sugars, leading to the accumulation of organic acids as end products (Sievers et al. 2005; Saichana et al. 2014). Among the most important acetic acid bacteria, the strains of genus Acetobacter are mainly involved in vinegar production (Elijah and Etukudo 2016). Vinegars are popular fermented foods produced by AAB present in natural environments (Nanda et al., 2001).
Vinegar is generally produced by inoculation of "seed vinegar", which is a microbiologically undefined starter culture, generally obtained from a previous fermentation. The lack of defined pure starter cultures is mainly due to problems such as isolation, cultivation and preservation of vinegar AAB. Several authors have mentioned that, even after successful isolation and cultivation, it is extremely difficult to handle the isolates and to preserve their high acetic acid resistance under laboratory conditions (Gullo and Guidici 2008). Several studies have recently been performed to characterize AAB from vinegar using molecular techniques (Muramatsu et al. 2009; Mounir et al. 2016).
AAB are often involved in the production of fermented foods, either in a beneficial (chocolate products, coffee, vinegar and specialty beers) or detrimental (spoilage of beers, wines and ciders) manner (Kersters et al., 2006). These bacteria have been isolated using several natural resources such as grape, coconut, palm and mangos (Kadere et al. 2008; Maal et al. 2010). In Burkina Faso, mango was produced abundantly and its fermented juice has been demonstrated to be a potential source of AAB (Ouattara et al. 2019).
The valorization of this fruit through biotechnological processes is therefore essential to reduce losses. Such valorization brings on the domestic market a new generation of highly prized and often imported products like vinegar (Ndoye et al., 2006). The present study aimed to isolate and identify indigenous strains of acetic acid bacteria from fermented juice of mangos in Burkina Faso.
Sampling and isolation of bacteria
Isolates of AAB were obtained from seven different mangos varieties collected in four cities of Burkina Faso (Banfora, Bobo-Dioulasso, Orodara and Ouagadougou). These cities were selected according to their annual mangos amount production. After sampling, GYEA (glucose, yeast extract, peptone of caseine, ethanol and acetic acid) medium was used as enrichment media (Shafiei et al. 2013). Strains were isolated using GYC standard medium (yeast extract, 10 g/l; D-glucose, 50 g/l; CaCO3, 30 g/l; agar, 25 g/l; distilled water, 1000 ml) and Carr medium (yeast extract, 3 %; agar, 2 %; bromocresol green, 0.002 %; ethanol, 2% (v/v); distilled water, 1000 ml) were used for phenotypical characteristic.
Morphological and biochemical characterization of isolated strains
The strains were characterized and identified using colony morphological characteristics and biochemical tests such as Gram staining, catalase, urea, sugar fermentation, motility, indole, oxidase, citrate utilization, gas and H2S production from glucose (Holt et al. 1994).
Morphological identification of bacteria was done with microscope on isolates from grow on the solid or liquid media. This characterization including shape, size, and arrangement was carried out from cells grown on GYC at 30ºC under aerobic condition (Cleenwerck et al., 2002; De Ley et al., 1984). Gram staining was done and optical observation was made at G x 100. Motility test was performed in Hanging drop slide. A drop of distilled water was taken in the glass slide and a single colony was taken from the GYC agar with a small tip and mixed it very well. Gas and H2S production from glucose was monitored using Kliger Iron Agar.
For catalase test, a small colony of good growth in GYC medium was smeared on a slide. One-drop catalase reagent (3 % H2O2) was added on the smear. The slide was observed for bubble formation (Kowser et al., 2015). Ketogenesis from glycerol was determined according modified method described (Aydin and Aksoy 2009). The isolates were inoculated in test tube containing YG medium (3.00% yeast extract, 3.00% glycerol) incubated at 30 ºC for 10 days and adding 8–10 drops of Fehling’s solution into the medium. The change of medium color to orange indicated a positive test.
Cellulose production was tested on GYE medium (2 % glucose, 0.50 % yeast extract, and 0. 25 % ethanol 95 %) incubated at 30 ºC for 7 days. Cellulose test was carried out using a Lugol’s iodine stain followed by 60 % sulphuric acid on pellicles from liquid culture, the color of cellulose fiber is blue (Romero-Cortes et al., 2012).
The sugar fermentation test was done on the liquid medium composed of peptone (3%); K2HPO4(0.05 %); KH2PO4 (0.05 %); MgSO4 (0.01 %); (NH4)2SO4 (0.14 %), with 1 % from sugar compound and 0.0022 % of blue bromotymol like indicator according to the method modified of Soumahoro et al. (2015). Acid production was indicated by the colour change reddish to yellow in the medium.
Molecular identification of isolated strains: DNA extraction and PCR
Extraction of genomic DNA:
DNA extraction was conducted from each isolate (preculture of 72 h) using GYC broth medium. A volume of 1 ml bacterial culture was centrifuged (12000 g for 5 minutes) and washed with sterile distilled water. The pellet was suspended in 700 ml sterile distilled, vortexed, to heat with the dry bath with 95°C/30 mn and to centrifuge (12000 g for 5 min). In another tube with Eppendorf were recovered the supernatant and addition 700 ml of pure alcohol to mixed and centrifuge (12000 g for 5mn). The filtrate was eliminated and after drying under the hood, the DNA was stored at -20°C by adding 50 ml sterile distilled water (N’tcha et al., 2016).
Amplification of DNA:
Amplification was performed according to the method using par N’tcha et al. (2016) and Yang et al. (2016). The PCR was performed in a 25 μl mixture consisted of 12.5 μl of 2 x Master Mix, 2.5 μl Forward primer (16sF: 5’ AGAGTTTGATCCTGGCTCAG 3’) and 2.5 μl Reverse primer (16sR: 5’ ACGGCTACCTTGTTTACGACTT 3’) and 10 μl of ADN. The amplification consisted of 30 PCR cycles in a Thermocycler (TECHEN). The cycling program was: initial denaturation at 95°C for 5 min followed by 30 cycles of denaturation with 94°C for 1 minute, hybridization for 44°C for 30 seconds and of elongation at 72°C for 2 min, final elongation at 73°C for 4 min and the amplified product cooled at 4°C
Electrophoresis
The DNA fragments were separated by loading 15 μl amplified DNA in a 1.5 % agarose gel at 110 V for 30 min. a 100 bp DNA ladder was used. The profiles obtained were visualized with the Ultra-violet trans-illuminator (Ultraviolet radiation type T. 05X20-2A; 254 nm) (N’tcha et al., 2016). A positive result is materialized by the presence of bands.
Sequencing
After purification of product PCR, strains were sequenced. Sequences obtained were assembled using software Sequencher (version 4.7) marked by Gene Code Corporation.
Contigs were matched with the data base «NCBI» (http// blast.ncbi.nlm.nih.gov). "Somewhat similar sequences (blastn)ʺ was choosed like programs. Dendrogram after blast was obtained using website BIBI.
Phenotypical characteristics of strains
Acetic acid bacteria were successfully isolated from sevenfermented mango juice. Phenotypical characteristics were used to isolate fifteen (15) AAB strains. Selected strains showed different kind of colonies color such as brownish, yellowish, creamy white and pinkish. The cells were bacilli squat in shape, single, paired Cluster or chain in cell arrangements. The cultural and morphology characteristics of isolated strains were showed in (Table1). Strains were Gram negative, positive for catalase test and negative for indole, H2S, citrate, ketogenesis and oxidase test. The preliminary identification base on biochemical tests were represented in (Table 2). All the isolates have capacity to ferment glucose and mannitol. A negative reaction was observed for lactose and maltose. Results revealed also that the profil of fermentation of strains vary according the sugar as sucrose, arabinose, saccharose, fructose, galactose, sucrose and meliobiose. The preliminary identification according to morphological, cultural biochemical tests brought about the possibility of selected strains to belong Acetobacter genus. Hence, molecular techniques were used to confirm identification.
| Cultural and morphological characteristics | ||||||
| Strains | Shape | Colour | Size | Aspect | Cell Morphology | Arrangements |
| CRSBAN-BVA1 | Round | brownish | 3mm | Smooth | Rod | Single, Paired or Chain |
| CRSBAN-BVA2 | Irregular round | creamy white | 2mm | Smooth | Rod | Single,Paired or Cluster |
| CRSBAN-BVA3 | Irregular round | pinkish | 3mm | Smooth | Rod | Single, Paired or Cluster |
| CRSBAN-BVA4 | Round | yellowish | 1,5mm | Smooth | Rod | Single, Paired or Chain |
| CRSBAN-BVK1 | Irregular round | creamy white | 2mm | Smooth | Rod | Single,Paired, or Cluster |
| CRSBAN-BVK2 | Irregular round | brownish | 2,5mm | Smooth | Rod | Single, Paired or Chain |
| CRSBAN-BVI1 | Irregular round | creamy white | 3mm | Smooth | Rod | Single, Paired or Cluster |
| CRSBAN-BVS1 | Round | brownish | 3mm | Smooth | Rod | Single, Paired or Cluster |
| CRSBAN-BVS2 | Irregular round | pinkish | 2,5mm | Smooth | Rod | Single, Paired or Chain |
| CRSBAN-BVL1 | Irregular round | creamy white | 1,5mm | Smooth | Rod | Single, Paired or Cluster |
| CRSBAN-BVL2 | Round | yellowish | 2mm | Smooth | Rod | Single, Paired or Chain |
| CRSBAN-BVB1 | Round | brownish | 3mm | Smooth | Rod | Single, Paired or Cluster |
| CRSBAN-BVB2 | Irregular round | pinkish | 3mm | Smooth | Rod | Single, Paired or Chain |
| CRSBAN-BVP1 | Irregular round | brownish | 2mm | Smooth | Rod | Single, Paired or Chain |
| CRSBAN-BVP2 | Irregular round | creamy white | 1,5mm | Smooth | Rod | Single, Paired or Chain |
| Strains | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | 13 | 14 | 15 | ||
| Biochemical characteristics | ||||||||||||||||
| Gram | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| Mobility | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | |
| Catalase | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | |
| Oxydase | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| Urea | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| Indol | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| H2S | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| Gaz | + | - | - | - | + | - | - | + | + | + | - | + | - | - | - | |
| Citrate | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| Cellulose Production | + | - | + | - | + | - | - | + | + | - | - | + | + | + | + | |
| Suroxydation | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | |
| Ketogenesis from glycerol | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| Substrates oxidized | ||||||||||||||||
| Glucose | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | |
| Lactose | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| Sucrose | + | - | - | - | - | + | - | - | - | - | + | - | - | - | - | |
| Mannitol | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | |
| Fructose | + | - | - | + | - | + | + | - | - | + | + | - | - | - | - | |
| Maltose | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| Arabinose | + | - | - | - | - | + | - | - | - | - | + | - | - | - | - | |
| Saccharose | - | - | - | + | + | - | + | + | + | + | - | - | + | + | - | |
| Galactose | + | - | - | - | - | + | + | - | - | - | + | - | - | + | - | |
| Meliobiose | + | + | + | + | - | - | - | + | + | + | + | - | - | - | + | |
| Sodium Ac | - | - | + | - | + | + | - | + | - | + | + | - | - | + | - | |
Isolated strains identified by molecular techniques
The 16S rRNA gene of 15 isolates was amplified by PCR. After amplification, twelve (12) isolates of AAB (CRSBANBVA1, CRSBAN - BVA2, CRSBAN - BVA3, CRSBAN - BVK1, CRSBAN- BVK2, CRSBAN- BVI1, CRSBAN- BVS1, CRSBANBVS2, CRSBAN- BVB1, CRSBAN- BVB2, CRSBAN- BVL2, CRSBAN- BVP2) presented each a clear band roughly 1200 Pb (Figure1). No band was observed after visualization of freezing with three isolates (CRSBAN- BVP1, CRSBAN- BVA4 and CRSBAN- BVL1) who did not presented a band. These results confirm those provided by the biochemical tests. Result obtained after sequencing made possible to establish the consecutive alignment of the nucleotidic sequences 16s rRNA of CRSBAN- BVK2 (Table 3). Comparaison of the nucleitidic sequence showed a rate homology 100 % with Acetobacter tropicalis. This alignment made possible to obtain the phylogenetic tree illustrated by (Figure 2).
Figure 1. PCR product of the amplified 16s rRNA from the isolates.
Taxa: 1: CRSBAN-BVP1; 2: CRSBAN-BVB1; 3: CRSBAN-BVL2; 4: CRSBAN-BVI1;5: CRSBAN-BVK1; 6: CRSBAN-BVA7; 7: CRSBAN-BVA5; 8: CRSBAN-BVA2; 9: CRSBAN-BVA1; 10: CRSBAN-BVB2; 1: CRSBANBVL3; 12: CRSBAN-BVP2; 13: CRSBAN-BVS2; 14: CRSBAN-BVK2; 15: CRSBAN-BVS1.
| Closest species based on 16S rRNA sequence | Acession number of 16SrRNA ref seq | % of 16s rRNA similarity |
Closest species based on 16S rRNA sequence | Acession number of 16SrRNA ref seq | % of 16s rRNA similarity |
|---|---|---|---|---|---|
| Gluconacetobacter entanii | URS0000594DA5 | 95,65% | Acetobacter ghanensis | URS0000577E5C | 97,06% |
| Gluconacetobacter maltiaceti | URS0000895280 | 95,75% | Acetobacter lovaniensis | URS0000614560 | 96,77% |
| Gluconacetobacter persimmonis | URS0000597324 | 95,83% | Acetobacter fabarum | URS0000522087 | 96,65% |
| Komagataeibacter hansenii | URS000026533D | 96,04% | Acetobacter okinawensis | URS00000F16C5 | 96,64% |
| Komagataeibacter medellinensis | URS00002AF7AD | 96,06% | Acetobacter lambici | URS0000183F1B | 96,75% |
| Komagataeibacter kakiaceti | URS00003FC71F | 96,15% | Acetobacter syzygii | URS000031846E | 96,74% |
| Komagataeibacter sucrofermentans | URS00003E0354 | 95,84% | Acetobacter suratthaniensis | URS0000A11BC6 | 96,35% |
| Komagataeibacter xylinus | URS0000100687 | 95,76% | Acetobacter pomorum | URS0000244AC2 | 96,46% |
| Komagataeibacter europaeus | URS0000535D4A | 95,97% | Acetobacter pasteurianus | URS00001956D5 | 95,16% |
| Komagataeibacter swingsii | URS000050A2EA | 96,04% | Acetobacter ascendens | URS00001AB487 | 96,33% |
| Komagataeibacter nataicola | URS000021747F | 95,94% | Acetobacter thailandicus | URS000084C389 | 97,45% |
| Komagataeibacter oboediens | URS00002FD334 | 96,04% | Acetobacter aceti | URS00005DFA0B | 97,87% |
| Komagataeibacter intermedius | URS000047B5CA | 96,17% | Acetobacter sicerae | URS00002AE1F4 | 97,86% |
| Komagataeibacter saccharivorans | URS0000184B3D | 96,06% | Acetobacter estunensis | URS000003DA3E | 97,56% |
| Gluconacetobacter takamatsuzukensis | URS0000353452 | 96,35% | Acetobacter oeni | URS0000603B66 | 97,18% |
| Gluconacetobacter sacchari | URS00004A2906 | 96,27% | Acetobacter musti | URS0000A0F72D | 98,28% |
| Gluconacetobacter liquefaciens | URS00005F4503 | 96,17% | Acetobacter orientalis | URS000022E0BE | 98 ,59% |
| Ameyamaea chiangmaiensis | URS0000135F9B | 96,25% | Acetobacter cibinongensis | URS0000027BEC | 98,27% |
| Tanticharoenia sakaeratensis | URS000007C67C | 96,33% | Acetobacter senegalensis | URS00004FB952 | 97,98% |
| Kozakia baliensis | URS00004A75DA | 96,35% | Acetobacter tropicalis | URS00005FB346 | 100,00% |
| Asaia prunellae | URS00003B1AD4 | 95,87% | Acetobacter indonesiensis | URS0000135937 | 98,38% |
| Asaia astilbis | URS00004E59BC | 95,96% | Acetobacter persici | URS0000358DF0 | 98,48% |
| Asaia lannensis | URS0000538C5C | 96,15% |
Not all mediums allow the growth of AAB; they are selective from isolates. GYC medium is the allowing medium of isolation of the majority of isolates in traditional vinegar (Gullo et al., 2006). In GYC agar, colonies presented different types of color (Table 1) and showed a clear halo. (Mounir et al. 2016) found the similar result. According (Sengun and Karabiyikli 2011), halo formation was caused by hydrolysis of CaCO3 contained in GYC by production of acid. That is one of the most basic and dominant characteristics that associate an unknown colony with acetic acid bacterial group. The methods based on the presence of a clear zone were not completely, because other strains, such as some lactic acid bacteria, could also form distinct clear zones (Chen et al. 2016). Morphological characteristics of bacteria presented in (Table 1) are similar to those obtained by (Yamada et al. 1999 and Lisdiyanti et al. 2001) who isolated Acetobacter spp and found this morphologically of cells.
Isolates were biochemically negative oxidase, positive catalase and negative Gram. Similar characteristics was found by (Zahoor et al. 2006 and Mamlouk and Gullo 2013). The fermentation of carbohydrate was variable among the isolates. This result was similar to that of (Kadere et al. 2008) of Acetobacter identification isolated in coconut. According to (Mamlouk and Gullo 2013), AAB are known for their ability to partially oxidize a variety of carbohydrates and to release the corresponding metabolites (aldehydes, ketones and organic acids) into the media. They are also characterized by the ability to oxidize alcohols or sugars incompletely, and a common feature to most of them is the ability to oxidize ethanol to acetic acid. All isolate about in Carr medium supplemented with bromocresol blue produce acid to convert medium color from blue to yellow. This media was used to differentiate Acetobacter form other genus of AAB that turns the media colour to yellow and then to green. (Mounir et al. 2016) who had found isolates obtained from apple and date fruits, cactus and vinegar can able convert Carr medium color from blue to yellow obtained the similar result.
According to this biochemical characterization, all isolate were classified to Acetobacter genus. In addition to these results, molecular identification was performed this morphology and biochemical test.
The 16S rRNA gene of isolates was successfully amplified by PCR. After amplified, twelve isolates were further proven genus Acetobater sp. The amplified PCR products of isolates were roughly 1200 bp (Figure 1). (Sharafi et al. 2010) obtained similar results using the same primer and to identify the strain of Acetobacter like Acetobacter pasteurianus (1339 bp). (Bellankimath et al. 2017) have used the same primer pairs to identify the genus Acetobacter and the amplified PCR products were roughly 1454 bp and 1473 bp. The difference between amplified PCR products could depend on subtracts. These results indicate the twelve constraints used in this study with the bacillary form belong to these results of the Acetobacter genus. Hence most of the authors reported molecular procedures based on restriction fragment analysis like 16s rRNA as a leaving appropriate technique for characterization of microorganisms (Poblet et al., 2000; González et al., 2006). Twelve (12) isolats of AAB that were classified to Acetobacter genus, only one of these isolates (CRSBAN-BVK2) were identified to be Acetobacter tropicalis after sequencing. The result of rate identification was similar to those obtained by Ghariani et al. (2017) during alignment of nucleotidic sequence 16S rRNA of Acetobacter tropicalis isolated from sap palm but higher to those obtained by Ouattara et al. (2019) who found 99.90 % of rate homology with Acetobacter tropicalis from sequencing of CRSBAN-BVA1. (Ndoye et al. 2007) in their study on the diversity of AAB (Acetobacter senegalensis) isolated from mango fruit (Mangifera indica) in Senegal found a similarity range 93.3 % with Acetobacter tropicalis. The results showed that bacteria strain named CRSBANBVK2 belongs to Acetobacter tropicalis.
This study demonstrated the possibility to isolate and identify the indigenous Acetobacter strains in local fruit as mango. Twelve isolats were identified like Acetobacter after morphological, biochemical and molecular characteristics. One isolate was identified to Acetobacter tropicalis. These isolated strain could be used for biotechnological application. These results are suggested to study applicability of the isolated strain in industrial production of acetic acid.
The authors need to thank Laboratory Microbial Biotechnology then Laboratory of Food Technology (Department of Biochemistry and Microbiology, University of Joseph KI-ZERBO) for their helping and Laboratory of Biology and Molecular Typing in Microbiology, Department of Biochemistry and Cellular Biology, Technology and Faculty of Science (FAST), University of Abomey-Calavi for molecular characterization. Ministry for the Woman, national Solidarity, the Family and the humane Action for their help and the International Sciences Programme (ISPSweden).