International Research Journals
Reach Us +44 330 818 7254

International Research Journal of Biotechnology

All submissions of the EM system will be redirected to Online Manuscript Submission System. Authors are requested to submit articles directly to Online Manuscript Submission System of respective journal.

Development of SSR markers of mangosteen (Garcinia mangostana L.)

Abstract

Warid Ali Qosim, Sujin Patarapuwadol and Kazuo N. Watanabe

Assessment and utilization of diversity in plant genetic resources is very important to improve of plant species. A mangosteen (Garcinia mangostana L.) seed was formed obligate apomicts process. Genetic diversity of mangosteen was developed by using SSR markers. An inter-simple sequence repeat (ISSR)- suppression - PCR technique established to SSR marker of plant spesies. DNA library construction was used restriction enzyme blunt end Rsa I and adaptor (consist of 48-mer: 5’GTAATACGACTCACTATAGG GCACGCGTGGTCGACGGCCCGGGCTGGT-3’ and 8-mer with the 3-end capped by an amino residue: 5’-ACCAGCCC-NH2-3). Primer designed by using compound SSR (AC)10; (TC)6(AC)5 or (AC)6(AG)5 and an adaptor primer AP2 and nested PCR using AP1 primers. The PCR product integrated into the plasmid PGEMT Easy Vector System and competence cell Escherichia coli (strain DH5α) and sequence. Eight sequence from sample #G17 with SSR compound (AC)10, (TC)6(AG)5 and (AC)6(AG)5 produced two primer pairs. The primer pairs from sequence positive clone 4 of SSR compound (TC)6(AC)5 were forward primer: 5’-GGCCGTT AAAGTAGCTCAAGAA-3’ and reverse primer:5’-CCGCATAGCATCAGTATCTG TC-3’, while primer pairs from sequence positive clone 10 of SSR compound (AC)6(AG)5 were forward primer: 5’-GTGTTTCCATTTGTTACGCGCT-3’ and reverse primer: 5’TAATGCCGTTGGGCAGTGA-3’.

Share this article

pinbahis